下載APKPureAPP獲取500 Lagu Pop Terbaru和其它安卓應用的最新版本 CG Am G Wes nasipe kudu koyo ngene Dm A G nduwe bojo kok ra tau ngepenakke Em A Dm - A seneng muring omongane sengak.. F G C kudu tak trimo bojoku pancen galak.. C G Am G Saben dino rasane ra karuan.. Dm ngrasakke bojoku A G sing ra tau perhatian Em nanging piye maneh A Dm atiku wes kadung tresno F senadyan batinku G C ngempet ono jero dodo.. Bidadarikeseleo mekso-mekso banget nganggo kawat abang ijo F Pupure medok mirok katon kandel separo G Dowo untune koyo sungai bengawan solo, solo C Am Bidadari kesleo ngempet" banget dadi pengen nduwe bojo F Opo mungkin samar yen ora keduman jodoh G Lan opo mungkin amung ngarep pengen mlekoto LirikLagu Bidadari Keseleo - Via Vallen, Lengkap dengan Chord Kunci Gitar: Intro : D Bm G LirikDan Chord Lagu Via Vallen - Bidadari Kesleo. INTRO G Em C D G Em Untumu.. ono kawate C D Ono lomboke, ono kangkunge G Em Yen mrenges.. ketok aslimu C D Ketok wagumu.. ketok mrongosmu G Bidadari keseleo G mekso-mekso banget Em nganggo kawat abang ijo Em Pupure medok mirok 31 500 Lagu Pop Terbaru APK تنزيل للاندرويد أفضل 500 أغنية البوب الاندونيسية أحدث وأفضل اختيار من 2018 NellaKharisma - Bidadari Kesleo Huda. Facebook Twitter. Chord Gitar Nella Kharisma - Bidadari Kesleo dan Liriknya [Intro] G Em C D G Em Untumu.. ono kawate C D Ono lomboke, ono kangkunge G Em Yen mrenges.. ketok aslimu C D Ketok wagumu.. ketok mrongosmu [Reff] G Bidadari keseleo Bidadarikesleo mekso mekso banget nganggo kawat abang ijo Pupure medok mirok katon kandel separo Dowo untune koyo sungai bengawan solo solo Bidadari kesleo ngempet-ngempet banget dadi pengen nduwe bojo Opo mungkin samar yen ora keduman jodoh Lan opo mungkin amung ngarep pengen mlekoto Bidadari kesleo mekso mekso banget nganggo kawat abang ijo Androidiçin 500 Lagu Pop Terbaru 3.1 APK indir. Top 500 Indonesian pop songs latest and best selection of 2018 ChordNella Kharisma Bidadari Kesleo (Hip Hop Dangdut Rap X) dengan chord diagram, versi lebih mudah. INTRO G Em C D G Em Untumu.. ono kawate C D Ono lomboke, ono kangkunge G Em Yen mrenges.. ketok aslimu C D Ketok wagumu.. ketok mrongosmu REFF G Bidadari keseleo G mekso-mekso banget Em nganggo kawat abang L1j4wgs. album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose NNNNFNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNNEmNNNNNNNNNCNNNNNNNNDNNNNNNNNGNNNNNNNNEmNNNNNNNNCNNNNNNNNNDNNNNNNNNGNNNNNNNNEmNNNNNNNNCNNNNNNNNNDNNNNNNNNGNNNNNNNNEmNNNNNNNNCNNNNNNNNNDNNNNNNNNGNNNNNNNNEmNNNNNNNNCNNNNNNNNNDNNNNNNNNGNNNNNNNNEmNNNNNNNNCNNNNNNNNDNNNNNNNNNGNNNNNNNNEmNNNNNNNNCNNNNNNNNDNNNNNNNNNGNNNNNNNNNEmNNNNNNNCNNNNNNNNDNNNNNNNNGNNNNNNNNNEmNNNNNNNNCNNNNNNNNDNNNNNNNNGNNNNNNNNNEmNNNNNNNNCNNNNNNNNDNNNNNNNNGNNNNNNNNNEmNNNNNNNNCNNNNNNNNDNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose CCCCCCAmCCCCCCCCCFmCCCCCmCCCDCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCFCCCCCCmCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCFCCCCCmCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCFCCDCCCCCCCCCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCCCFCCCCGCCCCCCCACCCCCCCFCCCCCCCCCCCCmCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose NDmNNNNDNNNNNNNCmNNNNNNNGNNNNNNNANNNNNNNDNNNNNNNCmNNNNNNNGNNNNNNNANNNNNNNDNNNNNNNCmNNNNNNNGNNNNNNNANNNNNNNDNNNNNNNCmNNNNNNNGNNNNNNNANNNNNNNNDNNNNNCmNNNNNNNNNGNNNNNNNANNNNNNNDNNNNNNNCmNNNNNNNGNNNNNNNANNNNNNNDNNNNNNNCmNNNNNNNGNNNNNNNANNNNNNNDNNNNNNNCmNNNNNNNGNNNNNNNANNNNNDNNNNNNNNNCmNNNNNNNGNNNNNNNANNNNNNNDNNNNNNNCmNNNNNNNGNNNNNNNANNNNNNNDNNNNNNNCmNNNNNNNGNNNNNNNANNNNNNNDNNNNNNNCmNNNNNNNGNNNNNNNANNNNNNNDNNNNNNCmNNNNNNNGNNNNNNNNANNNNNNNDNNNNNNNCmNNNNNNNGNNNNNNNANNNNNNNDNNNNNNNCmNNNNNNNGNNNNNNNANNNNNNNDNNNNNNNCmNNNNNNNGNNNNNNNANNNNNDNNNNNNNNNCmNNNNNNNGNNNNNNNANNNNNNNDNNNNNNNCmNNNNNNNGNNNNNNNANNNNNNNDNNNNNNNCmNNNNNNNGNNNNNNNANNNNNNNDNNNNNNNCmNNNNNNNGNNNNNNNANNNNNNNDNNNNNNCmNNNNNNNNGNNNNNNNANNNNNNNDNNNNNNNCmNNNNNNNGNNNNNNNANNNNNNNDNNNNNNNCmNNNNNNNGNNNNNNANNNNNNNNNNNNNNNNNNNN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login